version
PlantPromoterDB promoter information of 014-013-G10

Summary of Gene (014-013-G10)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0266900        NCBI 
Gene model 014-013-G10  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 8886040-8884841)

Genome position     
from initiation codon
013-080-C12         
014-010-A09         
014-019-D06         
014-030-F08         
014-039-C05         
014-053-H08         
014-089-F06         
014-094-A05         
014-098-C12         
AK119243            
AK119717            
D12635              
M80186              
TSS from cDNA
TSS information
014-013-G10                      5'->3' (-)
Promoter sequence






 
014-031-G08         
014-031-H07         
014-074-A04         
014-077-D06         
J023081F06          
J075180K07          
X75616              
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 014-013-G10

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-8885133-93

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCTCTATAAAAC-88851598885170-119-130
Y PatchCTCCCCTT-88851478885154-107-114
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGCCCATG-88852318885238-191-198
 OsREG467AGCCCATG PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGAGCCCAAG-88852588885265-218-225
 OsREG459AGCCCAAG PPDB MotifGCCCA  PLACE Motif 
REGTATGGGCTACAGCCCACCC-88852898885307-249-267
 OsREG465TATGGGCT            PPDB MotifGCCCA  PLACE Motif 
 OsREG435        ACAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG462          AGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG600           GCCCACCC PPDB MotifGCCCA  PLACE Motif 
REGATTTGGGCCGAAA-88853778885389-337-349
 OsREG493ATTTGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG563  TTGGGCCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA   PPDB MotifGCCCA  PLACE Motif 
 OsREG642    GGGCCGAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG634     GGCCGAAA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.