version
PlantPromoterDB promoter information of 014-034-A03

Summary of Gene (014-034-A03)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0634000        NCBI 
Gene model 014-034-A03  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 24983498-24982299)

Genome position     
from initiation codon
AK063673            
J100035E13          
TSS from cDNA
TSS information
014-034-A03                      5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 014-034-A03

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-24982573-75

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTTCTCC-2498253424982542-36-44
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGCGTCGCGTCGC-2498263724982649-139-151
 OsREG559CGCGTCGCGTCGC PPDB Motif  PLACE MotifCGACG 
 OsREG556 GCGTCGCG     PPDB Motif  PLACE MotifCGACG 
 OsREG583   GTCGCGTC   PPDB Motif  PLACE Motif 
REGACAGCCCATCTGGACC-2498266324982678-165-180
 OsREG435ACAGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG491 CAGCCCAT        PPDB MotifGCCCA  PLACE Motif 
 OsREG466  AGCCCATC       PPDB MotifGCCCA  PLACE Motif 
 OsREG456   GCCCATCT      PPDB MotifGCCCA  PLACE Motif 
 OsREG649        TCTGGACC PPDB Motif  PLACE Motif 
REGGTATGGGCCGGGACCCA-2498270624982722-208-224
 OsREG606GTATGGGC          PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG        PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG538    GGGCCGGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG637         GGGACCCA PPDB MotifGGGACCC  PLACE Motif 
REGAGCCCATTT-2498273524982743-237-245
 OsREG432AGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG422 GCCCATTT PPDB MotifGCCCA  PLACE Motif 
REGCACGTCACC-2498282724982835-329-337
 OsREG505CACGTCAC  PPDB MotifACGT  PLACE MotifTGAC 
 OsREG447 ACGTCACC PPDB MotifACGT  PLACE MotifTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.