version
PlantPromoterDB promoter information of 014-038-F03

Summary of Gene (014-038-F03)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0758000        NCBI 
Gene model 014-038-F03  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 32807103-32808302)

Genome position     
from initiation codon
013-065-E04         
014-002-E03         
014-004-B07         
014-072-G02         
014-078-E02         
014-081-H11         
016-060-C11         
AK064389            
AK074003            
AK105464            
J033076P21          
TSS from cDNA
TSS information
014-038-F03                      5'->3' (+)
Promoter sequence








 
006-114-B06         
AK061269            
AK071146            
J023081D16          
J043034B17          
J065027M09          
J065043F02          
J065086G05          
J065093A05          
J065109F16          
J065130N09          
J065154D24          
J065199L11          
J075166H22          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence








 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 014-038-F03

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+32807721-382

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGGTGGGCCCAAAACGGGCCGGT+3280748232807504-621-599
 OsREG600GGGTGGGC                PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG639    GGGCCCAA            PPDB MotifGCCCA  PLACE Motif 
 OsREG625     GGCCCAAA           PPDB MotifGCCCA  PLACE Motif 
 OsREG592      GCCCAAAA          PPDB MotifGCCCA  PLACE Motif 
 OsREG424            AACGGGCC    PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
 OsREG440               GGGCCGGT PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
REGTCGGCCCATCT+3280752732807537-576-566
 OsREG658TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490 CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590  GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG456   GCCCATCT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakCclone-32807462AK061269, AK061269, 006-114-B06, J065130N09, J065154D24, J043034B17, J065043F02, J065093A05, AK071146, J023081D16, J075166H22, J065086G05, J065109F16, J065199L11, J065027M09
TSS clone peakCclone-32807427AK061269, AK061269, 006-114-B06, J065130N09, J065154D24, J043034B17, J065043F02, J065093A05, AK071146, J023081D16, J075166H22, J065086G05, J065109F16, J065199L11, J065027M09

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGACCGGCCCGTTTTGGGCCCACCC-3280748232807504006-114-B06, AK061269, AK071146, J023081D16, J043034B17, J065027M09, J065043F02, J065086G05, J065093A05, J065109F16, J065130N09, J065154D24, J065199L11, J075166H22
 OsREG440ACCGGCCC                PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
 OsREG424   GGCCCGTT             PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
 OsREG592         TTTTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG625          TTTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG639           TTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG640             GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628              GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG600               GCCCACCC PPDB MotifGCCCA  PLACE Motif 
REGAGATGGGCCGA-3280752732807537006-114-B06, AK061269, AK071146, J023081D16, J043034B17, J065027M09, J065043F02, J065086G05, J065093A05, J065109F16, J065130N09, J065154D24, J065199L11, J075166H22
 OsREG456AGATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG  PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.