version
PlantPromoterDB promoter information of 014-079-B10

Summary of Gene (014-079-B10)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0434400        NCBI 
Gene model 014-079-B10  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 21617016-21618215)

Genome position     
from initiation codon
AK063725            
TSS from cDNA
TSS information
014-079-B10                      5'->3' (+)
Promoter sequence




 
AK101879            
J033070J24          
J100034D10          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 014-079-B10

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+21617964-52

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCCCACC+2161766821617675-348-341
 OsREG612GCCCCACC PPDB Motif  PLACE Motif 
REGCGCACGCGCGCGAG+2161769321617706-323-310
 OsREG555CGCACGCG       PPDB Motif  PLACE Motif 
 OsREG617     GCGCGCGA  PPDB Motif  PLACE Motif 
 OsREG558      CGCGCGAG PPDB MotifACGCGC  PLACE Motif 
REGCGCGCGACGCG+2161771621617726-300-290
 OsREG557CGCGCGAC    PPDB MotifACGCGC  PLACE Motif 
 OsREG556  CGCGACGC  PPDB Motif  PLACE MotifCGACG 
 OsREG559   GCGACGCG PPDB Motif  PLACE MotifCGACG 
REGGCCACGTC+2161772921617736-287-280
 OsREG585GCCACGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGGCCCACGCGT+2161773921617748-277-268
 OsREG602GCCCACGC   PPDB MotifGCCCA  PLACE Motif 
 OsREG530 CCCACGCG  PPDB MotifGCCCA  PLACE Motif 
 OsREG443  CCACGCGT PPDB Motif  PLACE Motif 
REGCCACGCGT+2161779821617805-218-211
 OsREG443CCACGCGT PPDB Motif  PLACE Motif 
REGCCACGGCC+2161782221617829-194-187
 OsREG521CCACGGCC PPDB Motif  PLACE Motif 
REGGCGCGCGA+2161788021617887-136-129
 OsREG617GCGCGCGA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.