version
PlantPromoterDB promoter information of 014-083-C12

Summary of Gene (014-083-C12)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0782500        NCBI 
Gene model 014-083-C12  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 34065704-34066903)

Genome position     
from initiation codon
013-043-A07         
013-068-B10         
013-093-A08         
AK063602            
AK119261            
J065013N12          
J075136E01          
J075149G04          
TSS from cDNA
TSS information
014-083-C12                      5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 014-083-C12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+34066350-354

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCCTCTCCTCC+3406632434066335-380-369
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGATGGGCT+3406610834066116-596-588
 OsREG607TGATGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG466 GATGGGCT PPDB MotifGCCCA  PLACE Motif 
REGATTTGGGCTTT+3406619034066200-514-504
 OsREG493ATTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG457 TTTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG426  TTGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG421   TGGGCTTT PPDB MotifGCCCA  PLACE Motif 
REGTTCGGCCCAAT+3406620234066212-502-492
 OsREG642TTCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG658 TCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG563  CGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG492   GGCCCAAT PPDB MotifGCCCA  PLACE Motif 
REGCAAGTGGG+3406621634066223-488-481
 OsREG498CAAGTGGG PPDB MotifGCCCA  PLACE Motif 
REGCGCGCGAC+3406626134066268-443-436
 OsREG557CGCGCGAC PPDB MotifACGCGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.