version
PlantPromoterDB promoter information of 014-084-A03

Summary of Gene (014-084-A03)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0290400        NCBI 
Gene model 014-084-A03  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 11675950-11674751)

Genome position     
from initiation codon
014-025-G08         
AK069705            
AK105355            
J023027D13          
J033111O15          
J065083E07          
J090026O12          
J090057G21          
TSS from cDNA
TSS information
014-084-A03                      5'->3' (-)
Promoter sequence

 
004-010-C07         
009-111-A08         
011-046-F10         
AK066894            
AK067122            
AK102868            
J013089O21          
J033072D17          
J033095M14          
J033111N23          
J043024M17          
J065176I24          
J090035C05          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence




 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 014-084-A03

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakCclone+11675817AK102868, 004-010-C07, AK066894, 011-046-F10, J013089O21, 009-111-A08, J065176I24, J033095M14, AK067122, J090035C05, J033072D17, J043024M17, AK102868, J033111N23
TSS clone peakAclone+11675904AK102868, 004-010-C07, AK066894, 011-046-F10, J013089O21, 009-111-A08, J065176I24, J033095M14, AK067122, J090035C05, J033072D17, J043024M17, AK102868, J033111N23

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTCTCT+1167583611675843004-010-C07, 009-111-A08, 011-046-F10, AK066894, AK067122, AK102868, J013089O21, J033072D17, J033095M14, J033111N23, J043024M17, J065176I24, J090035C05
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGGCCGTCCACGTGTCC+1167568811675703004-010-C07, 009-111-A08, 011-046-F10, AK066894, AK067122, AK102868, J013089O21, J033072D17, J033095M14, J033111N23, J043024M17, J065176I24, J090035C05
 OsREG624GGCCGTCC         PPDB Motif  PLACE Motif 
 OsREG434      CCACGTGT   PPDB MotifACGT  PLACE Motif 
 OsREG509       CACGTGTC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG451        ACGTGTCC PPDB MotifACGT  PLACE MotifACGTGKC 
REGCGTTGGAT+1167573511675742004-010-C07, 009-111-A08, 011-046-F10, AK066894, AK067122, AK102868, J013089O21, J033072D17, J033095M14, J033111N23, J043024M17, J065176I24, J090035C05
 OsREG481CGTTGGAT PPDB MotifCCAACGG  PLACE Motif 
REGAGCCCATT+1167580211675809004-010-C07, 009-111-A08, 011-046-F10, AK066894, AK067122, AK102868, J013089O21, J033072D17, J033095M14, J033111N23, J043024M17, J065176I24, J090035C05
 OsREG432AGCCCATT PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.