version
PlantPromoterDB promoter information of 015-008-G03

Summary of Gene (015-008-G03)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0712600        NCBI 
Gene model 015-008-G03  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 29571032-29569833)

Genome position     
from initiation codon
AK103705            
J033136N14          
TSS from cDNA
TSS information
015-008-G03                      5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 015-008-G03

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-29570725-693

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCAGCCCAAAA-2957077229570782-740-750
 OsREG657TCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511 CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG457  AGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG592   GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGCGCGTGGGCCTGGCCCACT-2957078929570807-757-775
 OsREG530CGCGTGGG            PPDB MotifGCCCA  PLACE Motif 
 OsREG602 GCGTGGGC           PPDB MotifGCCCA  PLACE Motif 
 OsREG571  CGTGGGCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG472   GTGGGCCT         PPDB MotifGCCCA  PLACE Motif 
 OsREG513    TGGGCCTG        PPDB MotifGCCCA  PLACE Motif 
 OsREG524     GGGCCTGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG577         CTGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG654          TGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG478           GGCCCACT PPDB MotifGCCCA  PLACE Motif 
REGCCAGCCCAG-2957081529570823-783-791
 OsREG523CCAGCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG512 CAGCCCAG PPDB MotifGCCCA  PLACE Motif 
REGTACTGGGCCTC-2957082529570835-793-803
 OsREG604TACTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG454 ACTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG473  CTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587   TGGGCCTC PPDB MotifGCCCA  PLACE Motif 
REGCAGGCCCAGCC-2957086129570871-829-839
 OsREG513CAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG473 AGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG620  GGCCCAGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG603   GCCCAGCC PPDB MotifGCCCA  PLACE Motif 
REGTGGTGGGCCCAGA-2957092029570932-888-900
 OsREG599TGGTGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG579    GGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG629     GGCCCAGA PPDB MotifGCCCA  PLACE Motif 
REGACACGTGGC-2957098229570990-950-958
 OsREG434ACACGTGG  PPDB MotifACGT  PLACE Motif 
 OsREG507 CACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.