version
PlantPromoterDB promoter information of 015-009-A10

Summary of Gene (015-009-A10)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0852500        NCBI 
Gene model 015-009-A10  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 36751067-36749868)

Genome position     
from initiation codon
AK068948            
J023001G15          
J053066H14          
J053084E08          
J065042G08          
J090010C10          
TSS from cDNA
TSS information
015-009-A10                      5'->3' (-)
Promoter sequence

 
009-174-G04         
AK063101            
J065131H12          
J065132F09          
J065200O15          
J090046K24          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence










 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 015-009-A10

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakCclone+36750347AK063101, J090046K24, J065131H12, AK063101, 009-174-G04

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTGGCCCATTA+3675018236750192009-174-G04, AK063101, J065131H12, J090046K24
 OsREG660TTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG488 TGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431  GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG610   GCCCATTA PPDB MotifGCCCA  PLACE Motif 
REGATATGGGCCCGGA+3675020436750216009-174-G04, AK063101, J065131H12, J090046K24
 OsREG480ATATGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG489  ATGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG566   TGGGCCCG   PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG543    GGGCCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG633     GGCCCGGA PPDB Motif  PLACE Motif 
REGAAGGCCCACGA+3675023736750247009-174-G04, AK063101, J065131H12, J090046K24
 OsREG430AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG472 AGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571  GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG601   GCCCACGA PPDB MotifGCCCA  PLACE Motif 
REGATATGGGCCCAGCCCAAG+3675025736750274009-174-G04, AK063101, J065131H12, J090046K24
 OsREG480ATATGGGC           PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG489  ATGGGCCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG579    GGGCCCAG       PPDB MotifGCCCA  PLACE Motif 
 OsREG620     GGCCCAGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG603      GCCCAGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG533       CCCAGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG523        CCAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG511         CAGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG459          AGCCCAAG PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.