version
PlantPromoterDB promoter information of 015-019-D06

Summary of Gene (015-019-D06)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0517900        NCBI 
Gene model 015-019-D06  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 25793261-25792062)

Genome position     
from initiation codon
AK064304            
TSS from cDNA
TSS information
015-019-D06                      5'->3' (-)
Promoter sequence
















 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 015-019-D06

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-25792350-89

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCCTCTCTCTCTCTCTCCTCTCCT-2579234925792373-88-112
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAAGCCCAAAAAAGGCCCATAT-2579239825792420-137-159
 OsREG419AAAAGCCC                PPDB MotifGCCCA  PLACE Motif 
 OsREG421 AAAGCCCA               PPDB MotifGCCCA  PLACE Motif 
 OsREG426  AAGCCCAA              PPDB MotifGCCCA  PLACE Motif 
 OsREG457   AGCCCAAA             PPDB MotifGCCCA  PLACE Motif 
 OsREG592    GCCCAAAA            PPDB MotifGCCCA  PLACE Motif 
 OsREG430            AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474             AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630              GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480               GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGGAGGCCCACCT-2579244925792459-188-198
 OsREG587GAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG472 AGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG476   GCCCACCT PPDB MotifGCCCA  PLACE Motif 
REGAAAAGCCCAACA-2579247625792487-215-226
 OsREG419AAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG421 AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG426  AAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG458   AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594    GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGCAAGCCCATTA-2579250325792513-242-252
 OsREG496CAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG429 AAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG432  AGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG610   GCCCATTA PPDB MotifGCCCA  PLACE Motif 
REGAAAAGCCCATTACGGCCCACAC-2579252525792546-264-285
 OsREG419AAAAGCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG421 AAAGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG429  AAGCCCAT             PPDB MotifGCCCA  PLACE Motif 
 OsREG432   AGCCCATT            PPDB MotifGCCCA  PLACE Motif 
 OsREG610    GCCCATTA           PPDB MotifGCCCA  PLACE Motif 
 OsREG645          TACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445           ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG564            CGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG627             GGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG598              GCCCACAC PPDB MotifGCCCA  PLACE Motif 
REGGAGGCCCATCT-2579255325792563-292-302
 OsREG587GAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590  GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG456   GCCCATCT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.