version
PlantPromoterDB promoter information of 015-035-H12

Summary of Gene (015-035-H12)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0911700        NCBI 
Gene model 015-035-H12  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 41483721-41482522)

Genome position     
from initiation codon
012-079-H01         
012-088-G05         
012-099-A01         
015-009-H07         
016-054-G03         
AK073805            
AK105441            
J033069I02          
J033086K01          
TSS from cDNA
TSS information
015-035-H12                      5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 015-035-H12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-41482831-110

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGCCACGTGTGGGCCGCA-4148289941482916-178-195
 OsREG448CGCCACGT           PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG507 GCCACGTG          PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434  CCACGTGT         PPDB MotifACGT  PLACE Motif 
 OsREG526     CGTGTGGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG598      GTGTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG627       TGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG564        GTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG618         TGGGCCGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG643          GGGCCGCA PPDB MotifGCCCA  PLACE Motif 
REGGCGTGGGC-4148294741482954-226-233
 OsREG602GCGTGGGC PPDB MotifGCCCA  PLACE Motif 
REGTGTGGGGCCCACGGGTCAGTGGGACGTGGC-4148300041483029-279-308
 OsREG611TGTGGGGC                       PPDB Motif  PLACE Motif 
 OsREG631 GTGGGGCC                      PPDB Motif  PLACE Motif 
 OsREG641  TGGGGCCC                     PPDB MotifGCCCA  PLACE Motif 
 OsREG647   GGGGCCCA                    PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC                   PPDB MotifGCCCA  PLACE Motif 
 OsREG571     GGCCCACG                  PPDB MotifGCCCA  PLACE Motif 
 OsREG547      GCCCACGG                 PPDB MotifGCCCA  PLACE Motif 
 OsREG531       CCCACGGG                PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG522              GTCAGTGG         PPDB Motif  PLACE MotifTGAC 
 OsREG585                      GACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGAGTGGGCCCAGA-4148303541483046-314-325
 OsREG478AGTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG579   GGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG629    GGCCCAGA PPDB MotifGCCCA  PLACE Motif 
REGGGCCCCAC-4148312141483128-400-407
 OsREG631GGCCCCAC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.