version
PlantPromoterDB promoter information of 015-046-G11

Summary of Gene (015-046-G11)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0498100        NCBI 
Gene model 015-046-G11  
Description NONE  
#
#

Overview

Focused view (chromosome 9: 19918788-19919987)

Genome position     
from initiation codon
AK064108            
AK120662            
J013067E09          
J013073O08          
J013158K14          
J065040H21          
J065062F05          
J065147B17          
J075098J22          
J090027P06          
J090048P11          
TSS from cDNA
TSS information
015-046-G11                      5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 015-046-G11

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+19919678-110

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGTGGGCCGGA+1991951119919521-277-267
 OsREG478AGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG564 GTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542  TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG644   GGGCCGGA PPDB MotifGCCCA  PLACE Motif 
REGTTGGCCCATGGGCTAAAGCCCAG+1991952419919546-264-242
 OsREG660TTGGCCCA                PPDB MotifGCCCA  PLACE Motif 
 OsREG488 TGGCCCAT               PPDB MotifGCCCA  PLACE Motif 
 OsREG517  GGCCCATG              PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG525   GCCCATGGGC           PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG467      CATGGGCT          PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG421              AAAGCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG428               AAGCCCAG PPDB MotifGCCCA  PLACE Motif 
REGAAGGCCCATAC+1991957919919589-209-199
 OsREG430AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630  GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG606   GCCCATAC PPDB MotifGCCCA  PLACE Motif 
REGTCAGGCCCATCA+1991960119919612-187-176
 OsREG646TCAGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG513 CAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474  AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590   GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607    GCCCATCA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.