version
PlantPromoterDB promoter information of 015-089-B03

Summary of Gene (015-089-B03)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0244200        NCBI 
Gene model 015-089-B03  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 7675152-7676351)

Genome position     
from initiation codon
003-114-A11         
016-048-G01         
AK101837            
AK105771            
AK107182            
J065054I12          
J065208F20          
J075088F18          
J075120G01          
J075147M20          
J075151J03          
J100064H21          
TSS from cDNA
TSS information
015-089-B03                      5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 015-089-B03

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+7675780-372
TSS clone peakCclone+7676059-93

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCTCTATAAATG+76757417675752-411-400
TATA BoxGTCTATAAAAG+76760217676031-131-121
Y PatchCCTCCTCT+76757387675745-414-407
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCCACCA+76757177675724-435-428
 OsREG599GCCCACCA PPDB MotifGCCCA  PLACE Motif 
REGATTTGGGC+76758167675823-336-329
 OsREG493ATTTGGGC PPDB MotifGCCCA  PLACE Motif 
REGCGTGTGGGG+76758467675854-306-298
 OsREG526CGTGTGGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG535 GTGTGGGG PPDB Motif  PLACE Motif 
REGAGCCCAAG+76759087675915-244-237
 OsREG459AGCCCAAG PPDB MotifGCCCA  PLACE Motif 
REGTAGGCCCACTCT+76759457675956-207-196
 OsREG656TAGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG472 AGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG478  GGCCCACT   PPDB MotifGCCCA  PLACE Motif 
 OsREG455    CCCACTCT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.