version
PlantPromoterDB promoter information of 015-097-H12

Summary of Gene (015-097-H12)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0687900        NCBI 
Gene model 015-097-H12  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 35576709-35577908)

Genome position     
from initiation codon
003-012-B10         
009-068-D03         
AK062547            
AK066910            
AK098928            
AK104333            
J013023N16          
J013031I07          
J013063L06          
J013091C11          
J013123M06          
J013126D14          
J023023E09          
J023039C19          
J023068D23          
J023080C21          
J033092J17          
J033112P12          
J033135O08          
J053023C13          
J065030O05          
J065065P07          
J065190O06          
J090011M19          
J090061F08          
J090064H09          
J090064P11          
TSS from cDNA
TSS information
015-097-H12                      5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 015-097-H12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+35576013-496
TSS cloneCclone+35576014-495
TSS clone peakAclone+35576019-490
TSS cloneGclone+35576050-459

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTATAAAAG+3557597835575985-531-524
Y PatchTCTCCCCC+3557600235576009-507-500
Y PatchTCTCCTCC+3557604235576049-467-460
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCACTGACACGTGGG+3557590535575919-604-590
 OsREG522CCACTGAC        PPDB Motif  PLACE MotifTGAC 
 OsREG510 CACTGACA       PPDB Motif  PLACE MotifTGAC 
 OsREG509     GACACGTG   PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434      ACACGTGG  PPDB MotifACGT  PLACE Motif 
 OsREG508       CACGTGGG PPDB MotifACGT  PLACE Motif 
REGAATGGGCT+3557594535575952-564-557
 OsREG432AATGGGCT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.