version
PlantPromoterDB promoter information of 015-099-E10

Summary of Gene (015-099-E10)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0471900        NCBI 
Gene model 015-099-E10  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 23319888-23318689)

Genome position     
from initiation codon
012-012-B06         
AK069434            
J023022E19          
J023131L03          
J033043P19          
J033127J16          
J033132P18          
J065059L10          
J065132E04          
TSS from cDNA
TSS information
015-099-E10                      5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 015-099-E10

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakTclone-23319040-152

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCCCCTCCC-2331901823319027-130-139
Y PatchCCCTTCTCC-2331902923319037-141-149
Y PatchCCCTTCCT-2331904023319047-152-159
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAAGCCCAGCCCATTT-2331909323319108-205-220
 OsREG655TAAGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG428 AAGCCCAG        PPDB MotifGCCCA  PLACE Motif 
 OsREG464  AGCCCAGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG603   GCCCAGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG533    CCCAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG523     CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG491      CAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG432       AGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG422        GCCCATTT PPDB MotifGCCCA  PLACE Motif 
REGTCTGGCCCATCA-2331912823319139-240-251
 OsREG638TCTGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG577 CTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG488  TGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590   GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607    GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGACAGCCCAACAAGGCCCATCG-2331914423319164-256-276
 OsREG435ACAGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG511 CAGCCCAA             PPDB MotifGCCCA  PLACE Motif 
 OsREG458  AGCCCAAC            PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594   GCCCAACA           PPDB MotifGCCCA  PLACE Motif 
 OsREG497         CAAGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG430          AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474           AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590            GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG553             GCCCATCG PPDB MotifGCCCA  PLACE Motif 
REGGCAGCCCAG-2331917723319185-289-297
 OsREG591GCAGCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG512 CAGCCCAG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.