PlantPromoterDB promoter information of 016-010-H02
Summary of Gene (016-010-H02)
|
Overview
|
Focused view (chromosome 2: 34090380-34089181)
|
Genome position
from initiation codon 006-065-C12 011-016-A10 011-027-G10 011-078-C10 012-039-F02 012-059-F07 012-088-B06 012-088-C06 012-090-F01 015-002-C09 015-004-C04 015-024-F11 015-038-C01 015-053-H02 015-057-G04 016-018-C07 016-048-B11 016-062-D03 016-077-H03 AF193803 AK064027 AK103783 AK119643 AK119885 J013021I16 J013049O14 J013063K17 J013072M15 J023027O06 J023065O13 J033061L05 J033071D23 J033091P12 J033124J07 J033144H23 J033145H23 J065063N13 J065186B09 J075055I18 J075177O06 J090008G10 J090050I24 J090062F21 J090071M09 J090078M03 J100018N15 J100035P04 J100037E03 J100045D04 J100062C01 J100065C13 J100068N10 J100074A11 J100077G20 TSS from cDNA TSS information 016-010-H02 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence |
|
|
|
Promoter Summary of 016-010-H02
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone peak | T | clone | - | 34089542 | -162 |
| TSS clone peak | C | clone | - | 34089541 | -161 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | CCATATAAAAA | - | 34089568 | 34089578 | -188 | -198 |
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | CTGACAGGTGGGCCCCACCAC | - | 34089600 | 34089620 | -220 | -240 | |||
| OsREG551 | CTGACAGG | PPDB Motif | PLACE Motif | TGAC | |||||
| OsREG501 | GACAGGTG | PPDB Motif | PLACE Motif | ||||||
| OsREG436 | ACAGGTGG | PPDB Motif | PLACE Motif | ||||||
| OsREG514 | CAGGTGGG | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG476 | AGGTGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG628 | GGTGGGCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG640 | GTGGGCCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG647 | TGGGCCCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG641 | GGGCCCCA | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG631 | GGCCCCAC | PPDB Motif | PLACE Motif | ||||||
| OsREG612 | GCCCCACC | PPDB Motif | PLACE Motif | ||||||
| OsREG527 | CCCACCAC | PPDB Motif | GCCCA | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||