version
PlantPromoterDB promoter information of 016-027-B12

Summary of Gene (016-027-B12)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0374400        NCBI 
Gene model 016-027-B12  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 15278917-15280116)

Genome position     
from initiation codon
AK069719            
J023020L05          
J023026H16          
J033025P22          
J075016I21          
J090015G21          
TSS from cDNA
TSS information
016-027-B12                      5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 016-027-B12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+15279768-149

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTC+1527975515279762-162-155
Y PatchCTCTCCTCCCCCCTC+1527980215279816-115-101
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGCCGGGCCCCACCCG+1527946915279484-448-433
 OsREG614GGCCGGGC         PPDB Motif  PLACE Motif 
 OsREG616 GCCGGGCC        PPDB Motif  PLACE Motif 
 OsREG543  CCGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG567   CGGGCCCC      PPDB MotifACGGGC  PLACE Motif 
 OsREG641    GGGCCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG631     GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG612      GCCCCACC   PPDB Motif  PLACE Motif 
 OsREG528        CCCACCCG PPDB MotifGCCCA  PLACE Motif 
REGGGTGGGCCCACCT+1527955815279570-359-347
 OsREG640 GTGGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628GGTGGGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG476     GCCCACCT PPDB MotifGCCCA  PLACE Motif 
REGTCCACGCCCCCGCG+1527958115279594-336-323
 OsREG636TCCACGCC       PPDB Motif  PLACE Motif 
 OsREG537      CCCCCGCG PPDB Motif  PLACE Motif 
REGTCCGTCCG+1527965115279658-266-259
 OsREG561TCCGTCCG PPDB Motif  PLACE Motif 
REGGCGTCGCGCCCACCT+1527967015279684-247-233
 OsREG556GCGTCGCG        PPDB Motif  PLACE MotifCGACG 
 OsREG476       GCCCACCT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.