version
PlantPromoterDB promoter information of 016-027-G04

Summary of Gene (016-027-G04)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0473900        NCBI 
Gene model 016-027-G04  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 23427205-23428404)

Genome position     
from initiation codon
                    
Os08g0473700        
TSS from cDNA
TSS information
016-027-G04                      5'->3' (+)
Promoter sequence

 
J065031A07          
J065129E01          
J065134I05          
J065212K13          
J065217M14          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence









 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 016-027-G04

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+23429295-160
TSS clone peakAclone+23429363-92

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCTATATATG+2342932823429337-127-118
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACCGGGCCCC+2342919423429203-261-252
 OsREG441ACCGGGCC   PPDB Motif  PLACE Motif 
 OsREG543 CCGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG567  CGGGCCCC PPDB MotifACGGGC  PLACE Motif 
REGTCCACGCC+2342925523429262-200-193
 OsREG636TCCACGCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone-23427991J065031A07, J065031A07, J065134I05, J065212K13, J065217M14, J065129E01

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCCCTCT-2342802923428039J065031A07, J065129E01, J065134I05, J065212K13, J065217M14
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAATTGGGCCCACGTGTC-2342805023428066J065031A07, J065129E01, J065134I05, J065212K13, J065217M14
 OsREG433AATTGGGC          PPDB MotifGCCCA  PLACE Motif 
 OsREG492 ATTGGGCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG639  TTGGGCCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC      PPDB MotifGCCCA  PLACE Motif 
 OsREG571     GGCCCACG     PPDB MotifGCCCA  PLACE Motif 
 OsREG449      GCCCACGT    PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG508       CCCACGTG   PPDB MotifACGT  PLACE Motif 
 OsREG434        CCACGTGT  PPDB MotifACGT  PLACE Motif 
 OsREG509         CACGTGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGCTCCCCCA-2342819023428197J065031A07, J065129E01, J065134I05, J065212K13, J065217M14
 OsREG574CTCCCCCA PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.