PlantPromoterDB promoter information of 016-028-C02

Summary of Gene (016-028-C02)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0577900        NCBI 
Gene model 016-028-C02  
Description NONE  


Focused view (chromosome 5: 28862350-28861151)

Genome position     
from initiation codon
TSS from cDNA
TSS information
016-028-C02                      5'->3' (-)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence


Promoter Summary of 016-028-C02

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
TSS clone peakGclone-28861421-71

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
 OsREG597TTGTGGGC                      PPDB MotifGCCCA  PLACE Motif 
 OsREG627 TGTGGGCC                     PPDB MotifGCCCA  PLACE Motif 
 OsREG472  GTGGGCCT                    PPDB MotifGCCCA  PLACE Motif 
 OsREG656   TGGGCCTA                   PPDB MotifGCCCA  PLACE Motif 
 OsREG437          ACATGGGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG490            ATGGGCCG          PPDB MotifGCCCA  PLACE Motif 
 OsREG542             TGGGCCGG         PPDB MotifGCCCA  PLACE Motif 
 OsREG538              GGGCCGGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG614               GGCCGGGC       PPDB Motif  PLACE Motif 
 OsREG616                GCCGGGCC      PPDB Motif  PLACE Motif 
 OsREG543                 CCGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG566                  CGGGCCCA    PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG489                   GGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG525                     GCCCATGG PPDB MotifGCCCA, CCATGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
TSS clone peakGclone+28861638AK065040, J013036A06, AK065040, J013001H17, J033122K08

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCTCCTC+2886162728861637AK065040, J013001H17, J013036A06, J033122K08
Y PatchCTCTCCTCC+2886166028861668AK065040, J013001H17, J013036A06, J033122K08

REG information

TypeSequenceAnnotationGenome positionGene model
REGCTCCCCCA+2886149628861503AK065040, J013001H17, J013036A06, J033122K08
REGCCATGGGCCCGGCCCATGTAGGCCCACAA+2886153528861563AK065040, J013001H17, J013036A06, J033122K08
 OsREG525CCATGGGC                      PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG489  ATGGGCCC                    PPDB MotifGCCCA  PLACE Motif 
 OsREG566   TGGGCCCG                   PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG543    GGGCCCGG                  PPDB MotifGCCCA  PLACE Motif 
 OsREG616     GGCCCGGC                 PPDB Motif  PLACE Motif 
 OsREG614      GCCCGGCC                PPDB Motif  PLACE Motif 
 OsREG538       CCCGGCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG542        CCGGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG490         CGGCCCAT             PPDB MotifGCCCA  PLACE Motif 
 OsREG437           GCCCATGT           PPDB MotifGCCCA  PLACE Motif 
 OsREG656                  TAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG472                   AGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG627                    GGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG597                     GCCCACAA PPDB MotifGCCCA  PLACE Motif 
REGTGTGGGCCTG+2886156528861574AK065040, J013001H17, J013036A06, J033122K08
REGTATGGGCCAG+2886157928861588AK065040, J013001H17, J013036A06, J033122K08

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.