PlantPromoterDB promoter information of 016-048-B11
Summary of Gene (016-048-B11)
|
Overview
|
Focused view (chromosome 2: 34090930-34089731)
|
Genome position
from initiation codon TSS from cDNA TSS information 016-048-B11 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence |
|
|
|
Promoter Summary of 016-048-B11
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone peak | T | clone | - | 34089542 | -162 |
| TSS clone peak | C | clone | - | 34089541 | -161 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | CCATATAAAAA | - | 34089568 | 34089578 | -188 | -198 |
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | CTGACAGGTGGGCCCCACCAC | - | 34089600 | 34089620 | -220 | -240 | |||
| OsREG551 | CTGACAGG | PPDB Motif | PLACE Motif | TGAC | |||||
| OsREG501 | GACAGGTG | PPDB Motif | PLACE Motif | ||||||
| OsREG436 | ACAGGTGG | PPDB Motif | PLACE Motif | ||||||
| OsREG514 | CAGGTGGG | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG476 | AGGTGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG628 | GGTGGGCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG640 | GTGGGCCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG647 | TGGGCCCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG641 | GGGCCCCA | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG631 | GGCCCCAC | PPDB Motif | PLACE Motif | ||||||
| OsREG612 | GCCCCACC | PPDB Motif | PLACE Motif | ||||||
| OsREG527 | CCCACCAC | PPDB Motif | GCCCA | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||