version
PlantPromoterDB promoter information of 016-084-F04

Summary of Gene (016-084-F04)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0572400        NCBI 
Gene model 016-084-F04  
Description NONE  
#
#

Overview

Focused view (chromosome 12: 23797234-23796035)

Genome position     
from initiation codon
AB110200            
AK065531            
J013025H03          
J013030L14          
J013034H02          
J033117N05          
J065027L09          
J065037D09          
J065197I09          
J090045C01          
J100031E11          
TSS from cDNA
TSS information
016-084-F04                      5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 016-084-F04

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-23797189-955

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAGCCCATAAGGCCCACCC-2379723423797253-1000-1019
 OsREG421AAAGCCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG429 AAGCCCAT            PPDB MotifGCCCA  PLACE Motif 
 OsREG465  AGCCCATA           PPDB MotifGCCCA  PLACE Motif 
 OsREG605   GCCCATAA          PPDB MotifGCCCA  PLACE Motif 
 OsREG430         AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG472          AGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628           GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG600            GCCCACCC PPDB MotifGCCCA  PLACE Motif 
REGGAGGCCCATGT-2379725923797269-1025-1035
 OsREG587GAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517  GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG437   GCCCATGT PPDB MotifGCCCA  PLACE Motif 
REGACATGGGCCTC-2379727323797283-1039-1049
 OsREG437ACATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG517 CATGGGCC   PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG474  ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587   TGGGCCTC PPDB MotifGCCCA  PLACE Motif 
REGATGGCCCACAA-2379730323797313-1069-1079
 OsREG487ATGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG627  GGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG597   GCCCACAA PPDB MotifGCCCA  PLACE Motif 
REGCCCACTCCGGGCC-2379732123797333-1087-1099
 OsREG532CCCACTCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG633     TCCGGGCC PPDB Motif  PLACE Motif 
REGGCAGCCCAAACATATGGGCCGCA-2379735323797375-1119-1141
 OsREG591GCAGCCCA                PPDB MotifGCCCA  PLACE Motif 
 OsREG511 CAGCCCAA               PPDB MotifGCCCA  PLACE Motif 
 OsREG457  AGCCCAAA              PPDB MotifGCCCA  PLACE Motif 
 OsREG593   GCCCAAAC             PPDB MotifGCCCA  PLACE Motif 
 OsREG480           ATATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG630            TATGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG490             ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG618              TGGGCCGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG643               GGGCCGCA PPDB MotifGCCCA  PLACE Motif 
REGTGAGGGAC-2379743723797444-1203-1210
 OsREG652TGAGGGAC PPDB MotifGGGACCC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.