version
PlantPromoterDB promoter information of AB037681

Summary of Gene (AB037681)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0716700        NCBI 
Gene model AB037681  
Description Similar to Endoplasmin homolog precursor (GRP94 homolog).  
#
#

Overview

Focused view (chromosome 6: 31328363-31327164)

Genome position     
from initiation codon
003-131-H06         
011-068-E02         
011-079-B11         
012-047-E05         
012-080-E12         
AK063385            
AK102478            
J013030D18          
J013068A13          
J013110L10          
J013154B08          
J013155A13          
J013170L05          
J023025I08          
J023101D23          
J023107H16          
J023129F05          
J033024C15          
J033075G15          
J033094I10          
J033127G08          
J033148L10          
J053097E20          
J065001H08          
J065061K24          
J065127I05          
J065129L22          
J065198E15          
J065213B03          
J090007C13          
J090007H08          
J090012D19          
J090013P17          
J090014J11          
J090029I02          
J090034D11          
J090037H04          
J090037N11          
J090038F21          
J090040P14          
J090047F09          
J090047L04          
J090052M10          
J090055O17          
J090062L19          
J090064L18          
J090065D10          
J090069E14          
J090077N15          
J090080B16          
J090081K14          
J090081N09          
J090093I02          
J090097B03          
J090097N20          
J100049L02          
J100059A16          
J100065L24          
J100067E01          
J100082A20          
TSS from cDNA
TSS information
AB037681                         5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AB037681

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-31327439-76

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTCCTC-3132744031327450-77-87
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCCCGCGTGGACC-3132750631327519-143-156
 OsREG537CCCCCGCG       PPDB Motif  PLACE Motif 
 OsREG570      CGTGGACC PPDB Motif  PLACE Motif 
REGCACGTGGCG-3132752631327534-163-171
 OsREG507CACGTGGC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG448 ACGTGGCG PPDB MotifACGT  PLACE MotifACGTGKC 
REGCCGAGCCGTCCGATC-3132753831327552-175-189
 OsREG540CCGAGCCG        PPDB Motif  PLACE Motif 
 OsREG468   AGCCGTCC     PPDB Motif  PLACE Motif 
 OsREG562    GCCGTCCG    PPDB Motif  PLACE Motif 
 OsREG545     CCGTCCGA   PPDB Motif  PLACE Motif 
 OsREG484      CGTCCGAT  PPDB Motif  PLACE Motif 
 OsREG589       GTCCGATC PPDB Motif  PLACE Motif 
REGGCCACGTG-3132756631327573-203-210
 OsREG507GCCACGTG PPDB MotifACGT  PLACE MotifACGTGKC 
REGGCCCAGTA-3132758131327588-218-225
 OsREG604GCCCAGTA PPDB MotifGCCCA  PLACE Motif 
REGATCGGACGGC-3132763431327643-271-280
 OsREG484ATCGGACG   PPDB Motif  PLACE Motif 
 OsREG545 TCGGACGG  PPDB Motif  PLACE Motif 
 OsREG562  CGGACGGC PPDB Motif  PLACE Motif 
REGCCCAGCCC-3132766531327672-302-309
 OsREG533CCCAGCCC PPDB MotifGCCCA  PLACE Motif 
REGCGCCACGTGTCCGGCCC-3132769131327707-328-344
 OsREG448CGCCACGT          PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG507 GCCACGTG         PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434  CCACGTGT        PPDB MotifACGT  PLACE Motif 
 OsREG509   CACGTGTC       PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG451    ACGTGTCC      PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG644         TCCGGCCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.