version
PlantPromoterDB promoter information of AB095094

Summary of Gene (AB095094)

Organism Oryza sativa  
Chromosome 11  
Locus Os11g0448400        NCBI 
Gene model AB095094  
Description Similar to Sigma factor SIG2A.  
#
#

Overview

Focused view (chromosome 11: 16798037-16799236)

Genome position     
from initiation codon
AK066099            
J075053H03          
J075062F23          
J090029D08          
TSS from cDNA
TSS information
AB095094                         5'->3' (+)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AB095094

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+16798900-137

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCCTCCTTCCCT+1679885716798873-180-164
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGGGGAG+1679867516798682-362-355
 OsREG574TGGGGGAG PPDB Motif  PLACE Motif 
REGTGAGGGAC+1679871016798717-327-320
 OsREG652TGAGGGAC PPDB MotifGGGACCC  PLACE Motif 
REGTCCAACGGTC+1679874016798749-297-288
 OsREG548TCCAACGG   PPDB MotifCCAACGG  PLACE Motif 
 OsREG495  CAACGGTC PPDB MotifCCAACGG  PLACE Motif 
REGATGGCCCACA+1679875316798762-284-275
 OsREG487ATGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG627  GGCCCACA PPDB MotifGCCCA  PLACE Motif 
REGTGGATGGGCCCG+1679877316798784-264-253
 OsREG534TGGATGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG608 GGATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG590  GATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG489   ATGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG566    TGGGCCCG PPDB MotifGCCCA, ACGGGC  PLACE Motif 
REGGCCGGCCCAAACGGCCCACGAA+1679881116798832-226-205
 OsREG615GCCGGCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG563  CGGCCCAA             PPDB MotifGCCCA  PLACE Motif 
 OsREG625   GGCCCAAA            PPDB MotifGCCCA  PLACE Motif 
 OsREG593    GCCCAAAC           PPDB MotifGCCCA  PLACE Motif 
 OsREG420        AAACGGCC       PPDB MotifAAACG(C/G)  PLACE Motif 
 OsREG423         AACGGCCC      PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
 OsREG445          ACGGCCCA     PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG564           CGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571            GGCCCACG   PPDB MotifGCCCA  PLACE Motif 
 OsREG601             GCCCACGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG529              CCCACGAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.