version
PlantPromoterDB promoter information of AB189039

Summary of Gene (AB189039)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0695100        NCBI 
Gene model AB189039  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 30276589-30277788)

Genome position     
from initiation codon
AB189042            
AK059514            
AK066112            
J013051N02          
J013127M02          
J023007I05          
TSS from cDNA
TSS information
AB189039                         5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AB189039

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+30276864-725

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTCCCC+3027684930276856-740-733
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGGCCCAGC+3027665830276667-931-922
 OsREG653GTGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG578 TGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG620  GGCCCAGC PPDB MotifGCCCA  PLACE Motif 
REGAGATGGGCCGGATAGGCCCAGA+3027667730276698-912-891
 OsREG456AGATGGGC               PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG             PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG            PPDB MotifGCCCA  PLACE Motif 
 OsREG644    GGGCCGGA           PPDB MotifGCCCA  PLACE Motif 
 OsREG656            TAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG473             AGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG629              GGCCCAGA PPDB MotifGCCCA  PLACE Motif 
REGAGCCCAAA+3027670430276711-885-878
 OsREG457AGCCCAAA PPDB MotifGCCCA  PLACE Motif 
REGGGACACGTGGG+3027672530276735-864-854
 OsREG451GGACACGT    PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG509 GACACGTG   PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434  ACACGTGG  PPDB MotifACGT  PLACE Motif 
 OsREG508   CACGTGGG PPDB MotifACGT  PLACE Motif 
REGTTCGTGGG+3027678430276791-805-798
 OsREG529TTCGTGGG PPDB MotifGCCCA  PLACE Motif 
REGGCGGGCCCACCA+3027680130276812-788-777
 OsREG619GCGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG566 CGGGCCCA    PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640  GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628   GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG599    GCCCACCA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakCclone+30277756AK059514

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGGGCTGGG+3027767130277678AK059514
 OsREG533GGGCTGGG PPDB MotifGCCCA  PLACE Motif 
REGGTGGGGGC+3027768030277687AK059514
 OsREG613GTGGGGGC PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.