version
PlantPromoterDB promoter information of AF042840

Summary of Gene (AF042840)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0319300        NCBI 
Gene model AF042840  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 11572474-11573673)

Genome position     
from initiation codon
006-021-E05         
006-022-H12         
009-187-E02         
AK059756            
AK070090            
J065008M05          
J065017J02          
J065019B18          
J065027O09          
J065028G17          
J065045N09          
J065078F21          
J065091H01          
J065112B19          
J065119K17          
J065127M19          
J065186E08          
J065199G12          
J075030K07          
J075050B02          
J075057G07          
J075070F01          
J075093N12          
J075095K13          
J075102D14          
J075103B17          
J075114K05          
J075142F18          
J075154L11          
J075185F08          
J090012A14          
J090020E22          
J090044L10          
J100044C12          
J100088J19          
TSS from cDNA
TSS information
AF042840                         5'->3' (+)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AF042840

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+11573339-135
TSS clone peakAclone+11573343-131

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCGGGTATAAAGG+1157330411573315-170-159
Y PatchTCTTCCCC+1157338111573388-93-86
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTCGCGTCGCG+1157304511573055-429-419
 OsREG583GTCGCGTC    PPDB Motif  PLACE Motif 
 OsREG559  CGCGTCGC  PPDB Motif  PLACE MotifCGACG 
 OsREG556   GCGTCGCG PPDB Motif  PLACE MotifCGACG 
REGACGCGTCC+1157309711573104-377-370
 OsREG442ACGCGTCC PPDB Motif  PLACE Motif 
REGCGCGGGGG+1157324011573247-234-227
 OsREG537CGCGGGGG PPDB Motif  PLACE Motif 
REGGAGGCGTGGA+1157326211573271-212-203
 OsREG503GAGGCGTG   PPDB Motif  PLACE Motif 
 OsREG636  GGCGTGGA PPDB Motif  PLACE Motif 
REGAACGGGCCGGT+1157327811573288-196-186
 OsREG424AACGGGCC    PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
 OsREG440   GGGCCGGT PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.