PlantPromoterDB promoter information of AF091458
Summary of Gene (AF091458)
|
Overview
|
Focused view (chromosome 7: 25452072-25453271)
|
Genome position
from initiation codon AJ011675 AK064704 J075159J15 J090034M06 J090079L24 TSS from cDNA TSS information AF091458 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence |
|
|
|
Promoter Summary of AF091458
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone peak | C | clone | + | 25448633 | -89 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | CCTTCCCTCCCCCTCCCTCTCTCTTCCTCCCCC | + | 25448607 | 25448639 | -115 | -83 |
| Y Patch | TCTTCCCC | + | 25448648 | 25448655 | -74 | -67 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | AGCCCACCGCAC | + | 25448336 | 25448347 | -386 | -375 | |||
| OsREG462 | AGCCCACC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG500 | CACCGCAC | PPDB Motif | PLACE Motif | ||||||
| REG | GCGGGCCCCA | + | 25448364 | 25448373 | -358 | -349 | |||
| OsREG619 | GCGGGCCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG567 | CGGGCCCC | PPDB Motif | ACGGGC | PLACE Motif | |||||
| OsREG641 | GGGCCCCA | PPDB Motif | GCCCA | PLACE Motif | |||||
| REG | TCGCGCGC | + | 25448421 | 25448428 | -301 | -294 | |||
| OsREG617 | TCGCGCGC | PPDB Motif | PLACE Motif | ||||||
| REG | CCCGTGGGCCCCACCGGGCC | + | 25448438 | 25448457 | -284 | -265 | |||
| OsREG531 | CCCGTGGG | PPDB Motif | GCCCA, ACGGGC | PLACE Motif | |||||
| OsREG547 | CCGTGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG571 | CGTGGGCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG640 | GTGGGCCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG647 | TGGGCCCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG641 | GGGCCCCA | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG631 | GGCCCCAC | PPDB Motif | PLACE Motif | ||||||
| OsREG612 | GCCCCACC | PPDB Motif | PLACE Motif | ||||||
| OsREG441 | ACCGGGCC | PPDB Motif | PLACE Motif | ||||||
| REG | GATCCGACGG | + | 25448484 | 25448493 | -238 | -229 | |||
| OsREG588 | GATCCGAC | PPDB Motif | CCGAC | PLACE Motif | |||||
| OsREG483 | ATCCGACG | PPDB Motif | CCGAC | PLACE Motif | CGACG | ||||
| OsREG546 | TCCGACGG | PPDB Motif | CCGAC | PLACE Motif | CGACG | ||||
| REG | TCCACGCC | + | 25448504 | 25448511 | -218 | -211 | |||
| OsREG636 | TCCACGCC | PPDB Motif | PLACE Motif | ||||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||