version
PlantPromoterDB promoter information of AF139665

Summary of Gene (AF139665)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0605200        NCBI 
Gene model AF139665  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 25447773-25448972)

Genome position     
from initiation codon
AF091458            
AJ011675            
AK064704            
J075159J15          
J090034M06          
J090079L24          
TSS from cDNA
TSS information
AF139665                         5'->3' (+)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AF139665

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+25448633-140

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTTCCCTCCCCCTCCCTCTCTCTTCCTCCCCC+2544860725448639-166-134
Y PatchTCTTCCCC+2544864825448655-125-118
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGCCCACCGCAC+2544833625448347-437-426
 OsREG462AGCCCACC     PPDB MotifGCCCA  PLACE Motif 
 OsREG500    CACCGCAC PPDB Motif  PLACE Motif 
REGGCGGGCCCCA+2544836425448373-409-400
 OsREG619GCGGGCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG567 CGGGCCCC  PPDB MotifACGGGC  PLACE Motif 
 OsREG641  GGGCCCCA PPDB MotifGCCCA  PLACE Motif 
REGTCGCGCGC+2544842125448428-352-345
 OsREG617TCGCGCGC PPDB Motif  PLACE Motif 
REGCCCGTGGGCCCCACCGGGCC+2544843825448457-335-316
 OsREG531CCCGTGGG             PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG547 CCGTGGGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG571  CGTGGGCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG647    TGGGCCCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG641     GGGCCCCA        PPDB MotifGCCCA  PLACE Motif 
 OsREG631      GGCCCCAC       PPDB Motif  PLACE Motif 
 OsREG612       GCCCCACC      PPDB Motif  PLACE Motif 
 OsREG441            ACCGGGCC PPDB Motif  PLACE Motif 
REGGATCCGACGG+2544848425448493-289-280
 OsREG588GATCCGAC   PPDB MotifCCGAC  PLACE Motif 
 OsREG483 ATCCGACG  PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG546  TCCGACGG PPDB MotifCCGAC  PLACE MotifCGACG 
REGTCCACGCC+2544850425448511-269-262
 OsREG636TCCACGCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.