version
PlantPromoterDB promoter information of AF323611

Summary of Gene (AF323611)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0637300        NCBI 
Gene model AF323611  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 27146265-27145066)

Genome position     
from initiation codon
006-090-C02         
009-003-E02         
009-123-H07         
015-011-D03         
AK069157            
AY026039            
J013112N19          
J023007C01          
J065019J20          
J065040O14          
J065095N12          
J065148O05          
J065196G05          
J065200B09          
J065200E14          
J065202A04          
J080301O18          
J080302K07          
J080302K12          
J080303E04          
J080304D04          
J080304I19          
J080305F03          
J080308J09          
J080308K11          
J080311M15          
J080311M23          
J080311O16          
J080318G03          
J090003N14          
J090016M02          
J090038F06          
TSS from cDNA
TSS information
AF323611                         5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AF323611

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-27145323-58

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGGCTCGG-2714540827145415-143-150
 OsREG540CGGCTCGG PPDB Motif  PLACE Motif 
REGGCGCGCGAG-2714541827145426-153-161
 OsREG617GCGCGCGA  PPDB Motif  PLACE Motif 
 OsREG558 CGCGCGAG PPDB MotifACGCGC  PLACE Motif 
REGCACACACC-2714546027145467-195-202
 OsREG499CACACACC PPDB Motif  PLACE Motif 
REGCCACTGACACCTGGGCCCCACC-2714555627145577-291-312
 OsREG522CCACTGAC               PPDB Motif  PLACE MotifTGAC 
 OsREG510 CACTGACA              PPDB Motif  PLACE MotifTGAC 
 OsREG550         CCTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG579          CTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647           TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641            GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631             GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG612              GCCCCACC PPDB Motif  PLACE Motif 
REGCTCGGCCCCACA-2714560227145613-337-348
 OsREG575CTCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG631   GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG611    GCCCCACA PPDB Motif  PLACE Motif 
REGCCACTGACA-2714561527145623-350-358
 OsREG522CCACTGAC  PPDB Motif  PLACE MotifTGAC 
 OsREG510 CACTGACA PPDB Motif  PLACE MotifTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.