version
PlantPromoterDB promoter information of AF529175

Summary of Gene (AF529175)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0346300        NCBI 
Gene model AF529175  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 16285176-16283977)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AF529175                         5'->3' (-)
Promoter sequence








 
009-023-F03         
AK058872            
AK102727            
J033105N07          
J100077I17          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence





 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AF529175

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-16283947-821

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGTATATAAGCA-1628397016283980-844-854
Y PatchCCCTTCTCC-1628390816283916-782-790
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCGGCCCAGCAAGGCCCATCG-1628399216284012-866-886
 OsREG618GCGGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CGGCCCAG             PPDB MotifGCCCA  PLACE Motif 
 OsREG620  GGCCCAGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG497         CAAGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG430          AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474           AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590            GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG553             GCCCATCG PPDB MotifGCCCA  PLACE Motif 
REGAGATGGGCTTGGGCTTT-1628402016284036-894-910
 OsREG456AGATGGGC          PPDB MotifGCCCA  PLACE Motif 
 OsREG466 GATGGGCT         PPDB MotifGCCCA  PLACE Motif 
 OsREG429  ATGGGCTT        PPDB MotifGCCCA  PLACE Motif 
 OsREG496   TGGGCTTG       PPDB MotifGCCCA  PLACE Motif 
 OsREG519    GGGCTTGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG459       CTTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG426        TTGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG421         TGGGCTTT PPDB MotifGCCCA  PLACE Motif 
REGGTGACGTGGC-1628405316284062-927-936
 OsREG505GTGACGTG   PPDB MotifACGT  PLACE MotifTGAC 
 OsREG585  GACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGGTGACGTGGC-1628410016284109-974-983
 OsREG505GTGACGTG   PPDB MotifACGT  PLACE MotifTGAC 
 OsREG585  GACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGGCCCACGA-1628416116284168-1035-1042
 OsREG601GCCCACGA PPDB MotifGCCCA  PLACE Motif 
REGCGTGGACCGGGCC-1628417416284186-1048-1060
 OsREG570CGTGGACC      PPDB Motif  PLACE Motif 
 OsREG441     ACCGGGCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone+16284322AK102727, J100077I17, AK102727, J033105N07, AK058872

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTC+1628433516284342AK058872, AK102727, J033105N07, J100077I17
Y PatchTCTCCCCC+1628435016284357AK058872, AK102727, J033105N07, J100077I17
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCCAAGCCCATCT+1628402516284036AK058872, AK102727, J033105N07, J100077I17
 OsREG519CCAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG496 CAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG429  AAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG466   AGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG456    GCCCATCT PPDB MotifGCCCA  PLACE Motif 
REGGCCACGTCAC+1628405316284062AK058872, AK102727, J033105N07, J100077I17
 OsREG585GCCACGTC   PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG505  CACGTCAC PPDB MotifACGT  PLACE MotifTGAC 
REGGCCACGTCAC+1628410016284109AK058872, AK102727, J033105N07, J100077I17
 OsREG585GCCACGTC   PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG505  CACGTCAC PPDB MotifACGT  PLACE MotifTGAC 
REGTCGTGGGC+1628416116284168AK058872, AK102727, J033105N07, J100077I17
 OsREG601TCGTGGGC PPDB MotifGCCCA  PLACE Motif 
REGGGCCCGGTCCACG+1628417416284186AK058872, AK102727, J033105N07, J100077I17
 OsREG441GGCCCGGT      PPDB Motif  PLACE Motif 
 OsREG570     GGTCCACG PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.