version
PlantPromoterDB promoter information of AJ308110

Summary of Gene (AJ308110)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0744700        NCBI 
Gene model AJ308110  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 32125610-32124411)

Genome position     
from initiation codon
                    
011-059-E02         
AF395537            
AK066446            
J013045G03          
J013055N15          
J013060C10          
J043027J24          
J075089C15          
J075114K08          
Os02g0744850        
TSS from cDNA
TSS information
AJ308110                         5'->3' (-)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AJ308110

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-32125071-461

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTTCCCT-3212507432125081-464-471
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGTGGGGCCCACTTG-3212515132125165-541-555
 OsREG612GGTGGGGC        PPDB Motif  PLACE Motif 
 OsREG631 GTGGGGCC       PPDB Motif  PLACE Motif 
 OsREG641  TGGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG647   GGGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG478     GGCCCACT   PPDB MotifGCCCA  PLACE Motif 
 OsREG498       CCCACTTG PPDB MotifGCCCA  PLACE Motif 
REGATGGCCCACCC-3212520332125213-593-603
 OsREG487ATGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG600   GCCCACCC PPDB MotifGCCCA  PLACE Motif 
REGGGCCCCACA-3212526032125268-650-658
 OsREG631GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG611 GCCCCACA PPDB Motif  PLACE Motif 
REGGACACGTGGGCCCCACAC-3212528732125304-677-694
 OsREG509GACACGTG           PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434 ACACGTGG          PPDB MotifACGT  PLACE Motif 
 OsREG508  CACGTGGG         PPDB MotifACGT  PLACE Motif 
 OsREG449   ACGTGGGC        PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG571    CGTGGGCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG640     GTGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG647      TGGGCCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG641       GGGCCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG631        GGCCCCAC   PPDB Motif  PLACE Motif 
 OsREG611         GCCCCACA  PPDB Motif  PLACE Motif 
 OsREG535          CCCCACAC PPDB Motif  PLACE Motif 
REGAGCCCACGA-3212534832125356-738-746
 OsREG463AGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG601 GCCCACGA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.