version
PlantPromoterDB promoter information of AJ575234

Summary of Gene (AJ575234)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0412200        NCBI 
Gene model AJ575234  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 19814753-19813554)

Genome position     
from initiation codon
006-028-H07         
AK059631            
AK099367            
AK104578            
J033051M06          
J033071L08          
J065056K06          
J065092I17          
J065156M13          
J065197K18          
J075026J11          
J075054F13          
J075123L05          
J075147D07          
J075175F03          
J100022E03          
J100062H05          
J100077K05          
TSS from cDNA
TSS information
AJ575234                         5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AJ575234

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-19814001-248
TSS clone peakCclone-19813998-245
TSS cloneCclone-19813996-243

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCCCTCTCCCCC-1981395319813965-200-212
Y PatchCCCCTCTCTC-1981399419814003-241-250
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATCCCCCA-1981404619814053-293-300
 OsREG482ATCCCCCA PPDB Motif  PLACE Motif 
REGAAGGCCCAAAT-1981405519814065-302-312
 OsREG430AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG493   GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGAAATGGGCCAA-1981408419814094-331-341
 OsREG422AAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG488  ATGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG660   TGGGCCAA PPDB MotifGCCCA  PLACE Motif 
REGCTTGGGCCAT-1981410719814116-354-363
 OsREG581CTTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG659 TTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG487  TGGGCCAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.