version
PlantPromoterDB promoter information of AJ605583

Summary of Gene (AJ605583)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0156900        NCBI 
Gene model AJ605583  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 3304186-3302987)

Genome position     
from initiation codon
015-072-A11         
AK073344            
AK106397            
TSS from cDNA
TSS information
AJ605583                         5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AJ605583

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-3303247-61

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCCTCTT-33032813303290-95-104
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACAGCCCATCA-33033333303343-147-157
 OsREG435ACAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG491 CAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG466  AGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607   GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGAAAGCCCATGT-33033493303359-163-173
 OsREG421AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG429 AAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG467  AGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG437   GCCCATGT PPDB MotifGCCCA  PLACE Motif 
REGTCCGGCCCACCA-33033693303380-183-194
 OsREG644TCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG564  CGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628   GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG599    GCCCACCA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.