version
PlantPromoterDB promoter information of AK058205

Summary of Gene (AK058205)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0613500        NCBI 
Gene model AK058205  
Description NONE  
#
#

Overview

Focused view (chromosome 12: 26215529-26216728)

Genome position     
from initiation codon
009-028-C05         
011-081-E10         
AK101273            
J033033A11          
TSS from cDNA
TSS information
AK058205                         5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK058205

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+26216520-9

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGCGTATAAACC+2621648326216493-46-36
Y PatchCCTCCCCCCCTC+2621651426216525-15-4
Y PatchTCTTCCTCCC+2621653326216542413
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACTGACA+2621628126216288-248-241
 OsREG510CACTGACA PPDB Motif  PLACE MotifTGAC 
REGCTGGGGCC+2621629726216304-232-225
 OsREG580CTGGGGCC PPDB Motif  PLACE Motif 
REGTCCACGCC+2621636226216369-167-160
 OsREG636TCCACGCC PPDB Motif  PLACE Motif 
REGCCACTGACAACCGGGCCCCACCACACACCCGGCCCCACA+2621639626216434-133-95
 OsREG522CCACTGAC                                PPDB Motif  PLACE MotifTGAC 
 OsREG510 CACTGACA                               PPDB Motif  PLACE MotifTGAC 
 OsREG441         ACCGGGCC                       PPDB Motif  PLACE Motif 
 OsREG543          CCGGGCCC                      PPDB MotifGCCCA  PLACE Motif 
 OsREG567           CGGGCCCC                     PPDB MotifACGGGC  PLACE Motif 
 OsREG641            GGGCCCCA                    PPDB MotifGCCCA  PLACE Motif 
 OsREG631             GGCCCCAC         GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG612              GCCCCACC                  PPDB Motif  PLACE Motif 
 OsREG527                CCCACCAC                PPDB MotifGCCCA  PLACE Motif 
 OsREG499                     CACACACC           PPDB Motif  PLACE Motif 
 OsREG538                           CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG611                               GCCCCACA PPDB Motif  PLACE Motif 
REGCATCCACCCATCCACC+2621643826216453-91-76
 OsREG515CATCCACCCATCCACC PPDB Motif  PLACE Motif 
 OsREG534      CCCATCCA   PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone+26216529009-028-C05, AB118018

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.