version
PlantPromoterDB promoter information of AK058256

Summary of Gene (AK058256)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0321900        NCBI 
Gene model AK058256  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 12897635-12898834)

Genome position     
from initiation codon
AK062103            
AK102574            
J013023P10          
J023068B11          
J023138N17          
J033071C08          
J033097O05          
J033101F15          
J033115M17          
J033143C10          
J033144B13          
J033145B13          
J053026E18          
J053060N18          
J053066B20          
J053066L22          
J053075N08          
J053093B03          
J053097K03          
J065009G12          
J065015B07          
J065025E20          
J065025G17          
J065031P03          
J065038M17          
J065053E10          
J065078I10          
J065081M13          
J065082I03          
J065084B20          
J065102M07          
J065105F16          
J065117H09          
J065135B22          
J065164N11          
J065176M06          
J065183O21          
J065217E24          
J075012A06          
J075062P09          
J075112D24          
J075121H06          
J075135L17          
J080304O16          
J090004O17          
J090015P06          
J090028O12          
J090030A18          
J090062N23          
J100019H21          
J100021E03          
J100024F20          
J100044N02          
J100051C24          
J100054N23          
J100077H18          
J100081G23          
TSS from cDNA
TSS information
AK058256                         5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK058256

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+12898457-178

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxAGTATATAAAC+1289842312898433-212-202
Y PatchTCTTCCTC+1289843912898446-196-189
Y PatchTTCCTCTCC+1289846212898470-173-165
Y PatchCCTCCCTC+1289848012898487-155-148
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCCAAAT+1289832312898330-312-305
 OsREG493GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGTAGGCCCATAGCCCATCA+1289833612898353-299-282
 OsREG656TAGGCCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT          PPDB MotifGCCCA  PLACE Motif 
 OsREG630  GGCCCATA         PPDB MotifGCCCA  PLACE Motif 
 OsREG466         AGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607          GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGCTCGCGCG+1289837412898381-261-254
 OsREG558CTCGCGCG PPDB MotifACGCGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.