version
PlantPromoterDB promoter information of AK058420

Summary of Gene (AK058420)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0456000        NCBI 
Gene model AK058420  
Description Mitochondrial glycoprotein family protein.  
#
#

Overview

Focused view (chromosome 5: 22453028-22451829)

Genome position     
from initiation codon
AK102036            
J065066F02          
Os05g0456200        
TSS from cDNA
TSS information
AK058420                         5'->3' (-)
Promoter sequence










 
AK099824            
J013102F11          
J013134N03          
J033132E14          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK058420

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-22452037-9

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTCT-2245201422452021147
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATCCAACGGTCCAGA-2245210322452117-75-89
 OsREG481ATCCAACG        PPDB MotifCCAACGG  PLACE Motif 
 OsREG548 TCCAACGG       PPDB MotifCCAACGG  PLACE Motif 
 OsREG495   CAACGGTC     PPDB MotifCCAACGG  PLACE Motif 
 OsREG649       GGTCCAGA PPDB Motif  PLACE Motif 
REGTCCGGCCCAACATGGATGGGCCTA-2245212522452148-97-120
 OsREG644TCCGGCCC                 PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA                PPDB MotifGCCCA  PLACE Motif 
 OsREG563  CGGCCCAA               PPDB MotifGCCCA  PLACE Motif 
 OsREG626   GGCCCAAC              PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594    GCCCAACA             PPDB MotifGCCCA  PLACE Motif 
 OsREG534            TGGATGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG608             GGATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG590              GATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG474               ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG656                TGGGCCTA PPDB MotifGCCCA  PLACE Motif 
REGTATGGGCCGC-2245216122452170-133-142
 OsREG630TATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG490 ATGGGCCG  PPDB MotifGCCCA  PLACE Motif 
 OsREG618  TGGGCCGC PPDB MotifGCCCA  PLACE Motif 
REGAGCCCAACA-2245217322452181-145-153
 OsREG458AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594 GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGATGGCCCACA-2245220322452212-175-184
 OsREG487ATGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG627  GGCCCACA PPDB MotifGCCCA  PLACE Motif 
REGGCGTGGGCGTGTGGCCCAAAA-2245221722452237-189-209
 OsREG602GCGTGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG573       CGTGTGGC       PPDB Motif  PLACE Motif 
 OsREG653          GTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG659           TGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625            GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG592             GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGGCCGGCCC-2245228222452289-254-261
 OsREG615GCCGGCCC PPDB MotifGCCCA  PLACE Motif 
REGGGCCGAGAT-2245230522452313-277-285
 OsREG635GGCCGAGA  PPDB Motif  PLACE Motif 
 OsREG485 GCCGAGAT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone-22452028J065066F02

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCTCCT-2245198322451990J065066F02
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.