version
PlantPromoterDB promoter information of AK058487

Summary of Gene (AK058487)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0510100        NCBI 
Gene model AK058487  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 19015447-19014248)

Genome position     
from initiation codon
AK122107            
J033126F06          
J053077L04          
J065010C11          
J075104O14          
J080003G03          
J080014K05          
J080026F03          
J080027O05          
J080037K15          
J080039D24          
J080043G19          
J080047P05          
J080048D22          
J080049F23          
J080062A21          
J080063H20          
J080067P15          
J080068P19          
J080079J15          
J080092K19          
J080096M04          
TSS from cDNA
TSS information
AK058487                         5'->3' (-)
Promoter sequence







 
AB049822            
AB049823            
J033028H23          
J100025H17          
J100037B11          
J100039K18          
J100043C03          
J100044N07          
J100048F06          
J100064G22          
J100065E13          
J100070F09          
J100073M20          
J100075O19          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK058487

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-19014641-44

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACAGGTGGG-1901472519014734-128-137
 OsREG501GACAGGTG   PPDB Motif  PLACE Motif 
 OsREG436 ACAGGTGG  PPDB Motif  PLACE Motif 
 OsREG514  CAGGTGGG PPDB MotifGCCCA  PLACE Motif 
REGATCTGGGCCCGC-1901475819014769-161-172
 OsREG486ATCTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG629 TCTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG579  CTGGGCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG566   TGGGCCCG  PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG619    GGGCCCGC PPDB MotifGCCCA  PLACE Motif 
REGGCCACGTC-1901477719014784-180-187
 OsREG585GCCACGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGCGTGTGGGGCCACGTCACAGTGGGCCCCA-1901481219014840-215-243
 OsREG526CGTGTGGG                      PPDB MotifGCCCA  PLACE Motif 
 OsREG535 GTGTGGGG                     PPDB Motif  PLACE Motif 
 OsREG611  TGTGGGGC                    PPDB Motif  PLACE Motif 
 OsREG631   GTGGGGCC                   PPDB Motif  PLACE Motif 
 OsREG585        GCCACGTC              PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG505          CACGTCAC            PPDB MotifACGT  PLACE MotifTGAC 
 OsREG478                  AGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG640                   GTGGGCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG647                    TGGGCCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG641                     GGGCCCCA PPDB MotifGCCCA  PLACE Motif 
REGGTGTGGGG-1901490319014910-306-313
 OsREG535GTGTGGGG PPDB Motif  PLACE Motif 
REGGTTTGGGC-1901493319014940-336-343
 OsREG593GTTTGGGC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.