version
PlantPromoterDB promoter information of AK058761

Summary of Gene (AK058761)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0440500        NCBI 
Gene model AK058761  
Description MIR domain containing protein.  
#
#

Overview

Focused view (chromosome 8: 21525498-21524299)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK058761                         5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK058761

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-21524741-243

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCCACGCCCACGG-2152480721524819-309-321
 OsREG636TCCACGCC      PPDB Motif  PLACE Motif 
 OsREG547     GCCCACGG PPDB MotifGCCCA  PLACE Motif 
REGTCTGGGCCCCAG-2152486521524876-367-378
 OsREG629TCTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG579 CTGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG641   GGGCCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG580    GGCCCCAG PPDB Motif  PLACE Motif 
REGACACGTGG-2152488321524890-385-392
 OsREG434ACACGTGG PPDB MotifACGT  PLACE Motif 
REGGCCACGTG-2152491221524919-414-421
 OsREG507GCCACGTG PPDB MotifACGT  PLACE MotifACGTGKC 
REGACGTGTCC-2152492221524929-424-431
 OsREG451ACGTGTCC PPDB MotifACGT  PLACE MotifACGTGKC 
REGGCCCATCA-2152496021524967-462-469
 OsREG607GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGCCACGGCCCATTA-2152500221525014-504-516
 OsREG521CCACGGCC      PPDB Motif  PLACE Motif 
 OsREG504 CACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445  ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490   CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431    GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG610     GCCCATTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.