version
PlantPromoterDB promoter information of AK058966

Summary of Gene (AK058966)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0270900        NCBI 
Gene model AK058966  
Description Mak16 protein family protein.  
#
#

Overview

Focused view (chromosome 7: 10003773-10004972)

Genome position     
from initiation codon
015-039-A02         
AK068904            
J013169N21          
J065039I11          
J065081J11          
J065162P04          
TSS from cDNA
TSS information
AK058966                         5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK058966

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+10004524-249

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTTCTCCTC+1000452910004539-244-234
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATTTGGGCCGC+1000443210004442-341-331
 OsREG493ATTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG563  TTGGGCCG  PPDB MotifGCCCA  PLACE Motif 
 OsREG618   TGGGCCGC PPDB MotifGCCCA  PLACE Motif 
REGAAATGGGCCTTGAGTGGGCCAAAGCCCATTA+1000445210004482-321-291
 OsREG422AAATGGGC                        PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC                       PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT                      PPDB MotifGCCCA  PLACE Motif 
 OsREG430   TGGGCCTT                     PPDB MotifGCCCA  PLACE Motif 
 OsREG497    GGGCCTTG                    PPDB MotifGCCCA  PLACE Motif 
 OsREG478            AGTGGGCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG654             GTGGGCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG660              TGGGCCAA          PPDB MotifGCCCA  PLACE Motif 
 OsREG421                    AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG429                     AAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG432                      AGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG610                       GCCCATTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.