version
PlantPromoterDB promoter information of AK058984

Summary of Gene (AK058984)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0246500        NCBI 
Gene model AK058984  
Description Similar to Minus dominance protein.  
#
#

Overview

Focused view (chromosome 1: 8068869-8067670)

Genome position     
from initiation codon
J065206E09          
J065210F04          
TSS from cDNA
TSS information
AK058984                         5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK058984

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-8067993-124

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGATCCGATCCGTCCCACC-80680558068074-186-205
 OsREG541CCGATCCGATCCG        PPDB Motif  PLACE Motif 
 OsREG651            GTCCCACC PPDB MotifGGGACCC  PLACE Motif 
REGGGGGCCCACCTGTC-80682178068230-348-361
 OsREG647GGGGCCCA       PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GGGCCCAC      PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGCCCACC     PPDB MotifGCCCA  PLACE Motif 
 OsREG476   GCCCACCT    PPDB MotifGCCCA  PLACE Motif 
 OsREG514    CCCACCTG   PPDB MotifGCCCA  PLACE Motif 
 OsREG436     CCACCTGT  PPDB Motif  PLACE Motif 
 OsREG501      CACCTGTC PPDB Motif  PLACE Motif 
REGTCCGGGCCGGGCCCAAAA-80682578068274-388-405
 OsREG633TCCGGGCC           PPDB Motif  PLACE Motif 
 OsREG544 CCGGGCCG          PPDB Motif  PLACE Motif 
 OsREG538   GGGCCGGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG614    GGCCGGGC       PPDB Motif  PLACE Motif 
 OsREG616     GCCGGGCC      PPDB Motif  PLACE Motif 
 OsREG543      CCGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG566       CGGGCCCA    PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG639        GGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625         GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG592          GCCCAAAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.