version
PlantPromoterDB promoter information of AK058987

Summary of Gene (AK058987)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0110900        NCBI 
Gene model AK058987  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 7: 605791-606990)

Genome position     
from initiation codon
J065032L02          
J065074H06          
J065168M23          
TSS from cDNA
TSS information
AK058987                         5'->3' (+)
Promoter sequence







 
009-107-B11         
AK062792            
J053026P09          
J053074L17          
J065057E24          
J065149B18          
J075002O20          
J075023C01          
J075063M22          
J090002C13          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence







 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK058987

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+606685-106

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTATATATAAATA+606651606662-140-129
Y PatchTCTCTCTCCC+606682606691-109-100
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGATGGGCCGGGCC+606533606546-258-245
 OsREG607TGATGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG     PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG    PPDB MotifGCCCA  PLACE Motif 
 OsREG538    GGGCCGGG   PPDB MotifGCCCA  PLACE Motif 
 OsREG614     GGCCGGGC  PPDB Motif  PLACE Motif 
 OsREG616      GCCGGGCC PPDB Motif  PLACE Motif 
REGAAAGCCCAAAT+606562606572-229-219
 OsREG421AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG426 AAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG457  AGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG493   GCCCAAAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone-606425AK062792, AK062792, 009-107-B11, J075002O20, J090002C13, J053026P09, J065057E24, J065149B18, J053074L17

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGGCCCGGCCCATCA-606533606546009-107-B11, AK062792, J053026P09, J053074L17, J065057E24, J065149B18, J075002O20, J090002C13
 OsREG616GGCCCGGC       PPDB Motif  PLACE Motif 
 OsREG614 GCCCGGCC      PPDB Motif  PLACE Motif 
 OsREG538  CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542   CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490    CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590     GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607      GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGATTTGGGCTTT-606562606572009-107-B11, AK062792, J053026P09, J053074L17, J065057E24, J065149B18, J075002O20, J090002C13
 OsREG493ATTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG457 TTTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG426  TTGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG421   TGGGCTTT PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.