version
PlantPromoterDB promoter information of AK059111

Summary of Gene (AK059111)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0209000        NCBI 
Gene model AK059111  
Description Similar to Dolichyl-di-phosphooligosaccharide-protein glycotransferase (Oligosaccharyltransferase)-like.  
#
#

Overview

Focused view (chromosome 7: 5916550-5917749)

Genome position     
from initiation codon
014-100-B03         
AK099319            
J065123N23          
J075035A02          
J075093B22          
J090054E07          
J090058E19          
J090084F03          
TSS from cDNA
TSS information
AK059111                         5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK059111

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+5917509-41

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCCTC+59174735917480-77-70
Y PatchCCTCCTCTCC+59174915917500-59-50
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCACTGACGGTGGGGCCGGA+59173235917342-227-208
 OsREG522CCACTGAC             PPDB Motif  PLACE MotifTGAC 
 OsREG612        GGTGGGGC     PPDB Motif  PLACE Motif 
 OsREG631         GTGGGGCC    PPDB Motif  PLACE Motif 
 OsREG644            GGGCCGGA PPDB MotifGCCCA  PLACE Motif 
REGCCGTCGGATC+59174105917419-140-131
 OsREG546CCGTCGGA   PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG483 CGTCGGAT  PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG588  GTCGGATC PPDB MotifCCGAC  PLACE Motif 
REGGATCGGACGGCCCAGAT+59174245917440-126-110
 OsREG589GATCGGAC          PPDB Motif  PLACE Motif 
 OsREG484 ATCGGACG         PPDB Motif  PLACE Motif 
 OsREG545  TCGGACGG        PPDB Motif  PLACE Motif 
 OsREG562   CGGACGGC       PPDB Motif  PLACE Motif 
 OsREG624    GGACGGCC      PPDB Motif  PLACE Motif 
 OsREG584     GACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445      ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG565       CGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG629        GGCCCAGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG486         GCCCAGAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.