version
PlantPromoterDB promoter information of AK059363

Summary of Gene (AK059363)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0810300        NCBI 
Gene model AK059363  
Description Similar to NBD-like protein.  
#
#

Overview

Focused view (chromosome 2: 35523818-35525017)

Genome position     
from initiation codon
AK099203            
J023118L21          
TSS from cDNA
TSS information
AK059363                         5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK059363

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+35524748-70

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCAGGCCCATAA+3552460835524619-210-199
 OsREG524CCAGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG513 CAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474  AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630   GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG605    GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGAAATGGGCCAGGGCCCAGG+3552462535524643-193-175
 OsREG422AAATGGGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG488  ATGGGCCA          PPDB MotifGCCCA  PLACE Motif 
 OsREG577   TGGGCCAG         PPDB MotifGCCCA  PLACE Motif 
 OsREG475         AGGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG579          GGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG550           GGCCCAGG PPDB MotifGCCCA  PLACE Motif 
REGTCGGCCCAAGGCCCAGTA+3552465135524668-167-150
 OsREG658TCGGCCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG563 CGGCCCAA          PPDB MotifGCCCA  PLACE Motif 
 OsREG581  GGCCCAAG         PPDB MotifGCCCA  PLACE Motif 
 OsREG497      CAAGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG430       AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG473        AGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG454         GGCCCAGT  PPDB MotifGCCCA  PLACE Motif 
 OsREG604          GCCCAGTA PPDB MotifGCCCA  PLACE Motif 
REGTGGTGGGC+3552467735524684-141-134
 OsREG599TGGTGGGC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.