version
PlantPromoterDB promoter information of AK059475

Summary of Gene (AK059475)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0697200        NCBI 
Gene model AK059475  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 29554965-29556164)

Genome position     
from initiation codon
015-013-B10         
AK102993            
J033079I18          
J033082A14          
J033115N07          
J033116E03          
J033124L17          
J065047H08          
J065131M14          
J090001F15          
J090050M03          
J090065P08          
J090093E07          
TSS from cDNA
TSS information
AK059475                         5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK059475

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+29555914-51

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACGCGAC+2955574329555750-222-215
 OsREG583GACGCGAC PPDB Motif  PLACE Motif 
REGATTGGGCCAC+2955578529555794-180-171
 OsREG492ATTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG659 TTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG653  TGGGCCAC PPDB MotifGCCCA  PLACE Motif 
REGAACGGGCCCACA+2955579629555807-169-158
 OsREG424AACGGGCC     PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
 OsREG566  CGGGCCCA   PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640   GGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG627    GGCCCACA PPDB MotifGCCCA  PLACE Motif 
REGACAGCCCACCAC+2955581229555823-153-142
 OsREG435ACAGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG462  AGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG599   GCCCACCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG527    CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGTGTTGGGCCGGT+2955583029555841-135-124
 OsREG594TGTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG626 GTTGGGCC    PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG563  TTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG440    GGGCCGGT PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
REGTGATGGGCCTGATGGGCCTT+2955584429555863-121-102
 OsREG607TGATGGGC TGATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC GATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG513   TGGGCCTG          PPDB MotifGCCCA  PLACE Motif 
 OsREG646    GGGCCTGA         PPDB MotifGCCCA  PLACE Motif 
 OsREG430            TGGGCCTT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.