version
PlantPromoterDB promoter information of AK059686

Summary of Gene (AK059686)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0520100        NCBI 
Gene model AK059686  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 25941706-25942905)

Genome position     
from initiation codon
003-002-C07         
AK120052            
J013000I20          
TSS from cDNA
TSS information
AK059686                         5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK059686

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+25941734-972
TSS clone peakTclone+25942568-138

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTTTGGGCCCACAA+2594159225941605-1114-1101
 OsREG592TTTTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG639  TTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG627     GGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG597      GCCCACAA PPDB MotifGCCCA  PLACE Motif 
REGGGTGTGTGGGCCCACCACGCGTGCTGGGCCCACC+2594163925941672-1067-1034
 OsREG499GGTGTGTG                           PPDB Motif  PLACE Motif 
 OsREG598   GTGTGGGC                        PPDB MotifGCCCA  PLACE Motif 
 OsREG627    TGTGGGCC                       PPDB MotifGCCCA  PLACE Motif 
 OsREG640     GTGGGCCCAC          GGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG628        GGCCCACC          GGCCCACC PPDB MotifGCCCA  PLACE Motif 
 OsREG599         GCCCACCA                  PPDB MotifGCCCA  PLACE Motif 
 OsREG527          CCCACCAC                 PPDB MotifGCCCA  PLACE Motif 
 OsREG443              CCACGCGT             PPDB Motif  PLACE Motif 
 OsREG620                      GCTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG579                       CTGGGCCC    PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.