version
PlantPromoterDB promoter information of AK059734

Summary of Gene (AK059734)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0673300        NCBI 
Gene model AK059734  
Description Similar to ZmRR2 protein (Response regulator 2).  
#
#

Overview

Focused view (chromosome 4: 34774949-34776148)

Genome position     
from initiation codon
006-055-C10         
J065006D12          
J065218N11          
TSS from cDNA
TSS information
AK059734                         5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK059734

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+34775847-102

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTGTATATATACGCC+3477581034775823-139-126
Y PatchTTCTCCTCTT+3477586634775875-83-74
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCAAGCCC+3477556334775570-386-379
 OsREG519CCAAGCCC PPDB MotifGCCCA  PLACE Motif 
REGCGTGTGGGTGTGGGCCCCACCCG+3477564434775666-305-283
 OsREG526CGTGTGGG                PPDB MotifGCCCA  PLACE Motif 
 OsREG598       GTGTGGGC         PPDB MotifGCCCA  PLACE Motif 
 OsREG627        TGTGGGCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG640         GTGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG647          TGGGCCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG641           GGGCCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG631            GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG612             GCCCCACC   PPDB Motif  PLACE Motif 
 OsREG528               CCCACCCG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.