version
PlantPromoterDB promoter information of AK060097

Summary of Gene (AK060097)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0608500        NCBI 
Gene model AK060097  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 25094620-25095819)

Genome position     
from initiation codon
016-025-C04         
AK070667            
J023014G18          
J023056L17          
J033112I06          
J053076L23          
J053079L21          
J065147A13          
J065167P14          
J065201I23          
J075052E21          
J075109J21          
J075127P04          
J075143O10          
J090006A02          
J090033O09          
J100033M09          
J100068B03          
J100087B08          
TSS from cDNA
TSS information
AK060097                         5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK060097

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+25095382-238
TSS clone peakAclone+25095400-220

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCCCC+2509540925095416-211-204
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTGGCCCACAA+2509526125095271-359-349
 OsREG577CTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG627  GGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG597   GCCCACAA PPDB MotifGCCCA  PLACE Motif 
REGAGCCCACA+2509529625095303-324-317
 OsREG461AGCCCACA PPDB MotifGCCCA  PLACE Motif 
REGCCAGCCCATCTTGGCCCACC+2509531525095334-305-286
 OsREG523CCAGCCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG491 CAGCCCAT            PPDB MotifGCCCA  PLACE Motif 
 OsREG466  AGCCCATC           PPDB MotifGCCCA  PLACE Motif 
 OsREG456   GCCCATCT          PPDB MotifGCCCA  PLACE Motif 
 OsREG660          TTGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG654           TGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG628            GGCCCACC PPDB MotifGCCCA  PLACE Motif 
REGTAAGCCCATT+2509533625095345-284-275
 OsREG655TAAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG429 AAGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG432  AGCCCATT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.