version
PlantPromoterDB promoter information of AK060178

Summary of Gene (AK060178)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0492100        NCBI 
Gene model AK060178  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 24407692-24406493)

Genome position     
from initiation codon
AK071053            
AK100101            
J023004I20          
J023067D13          
J033028G05          
J033060L15          
J033103N12          
J033125B19          
J065011E10          
J065053G23          
J065097M21          
J065132A12          
J065161F02          
J065162L05          
J090093I18          
J100061I05          
J100081G13          
TSS from cDNA
TSS information
AK060178                         5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK060178

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-24406751-59

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGGGTCC-2440681024406817-118-125
 OsREG622GTGGGTCC PPDB MotifGGGACCC  PLACE Motif 
REGAGTGGGCCTA-2440684324406852-151-160
 OsREG478AGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG472 GTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG656  TGGGCCTA PPDB MotifGCCCA  PLACE Motif 
REGAAATGGGCTGTATTTGGGCCAA-2440685424406875-162-183
 OsREG422AAATGGGC               PPDB MotifGCCCA  PLACE Motif 
 OsREG432 AATGGGCT              PPDB MotifGCCCA  PLACE Motif 
 OsREG491  ATGGGCTG             PPDB MotifGCCCA  PLACE Motif 
 OsREG435   TGGGCTGT            PPDB MotifGCCCA  PLACE Motif 
 OsREG493           ATTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG625            TTTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG659             TTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG660              TGGGCCAA PPDB MotifGCCCA  PLACE Motif 
REGATTTGGGCTGG-2440690524406915-213-223
 OsREG493ATTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG457 TTTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG511  TTGGGCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG523   TGGGCTGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.