PlantPromoterDB promoter information of AK060388

Summary of Gene (AK060388)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0358300        NCBI 
Gene model AK060388  
Description NONE  


Focused view (chromosome 1: 14656017-14654818)

Genome position     
from initiation codon
TSS from cDNA
TSS information
AK060388                         5'->3' (-)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence


Promoter Summary of AK060388

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
TSS clone peakAclone-14655792-25

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCCTC-1465582814655835-61-68

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
 OsREG527GTGGTGGG                PPDB MotifGCCCA  PLACE Motif 
 OsREG599 TGGTGGGC               PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGTGGGCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG564   GTGGGCCG             PPDB MotifGCCCA  PLACE Motif 
 OsREG542    TGGGCCGG            PPDB MotifGCCCA  PLACE Motif 
 OsREG440     GGGCCGGT           PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
 OsREG593           GTTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG457            TTTGGGCT    PPDB MotifGCCCA  PLACE Motif 
 OsREG426             TTGGGCTT   PPDB MotifGCCCA  PLACE Motif 
 OsREG421              TGGGCTTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG419               GGGCTTTT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
TSS clone peakCclone+14655991AK061826, J033025C03, J033095I15, J033112G18, 006-102-H05, 006-083-B11, 006-031-B11, J090001C14, J065100L16, J065176I05, AK061826, J013105M07, J033105E03, 006-088-H03, J013155A16, 006-083-C09, J090058E15, J090068F07, J033072L20, J033125D09

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCCTCTCTCCTCTT+1465598114655995006-031-B11, 006-083-B11, 006-083-C09, 006-088-H03, 006-102-H05, AK061826, J013105M07, J013155A16, J033025C03, J033072L20, J033095I15, J033105E03, J033112G18, J033125D09, J065100L16, J065176I05, J090001C14, J090058E15, J090068F07

REG information

TypeSequenceAnnotationGenome positionGene model
REGGGGCGAGG+1465572514655732006-031-B11, 006-083-B11, 006-083-C09, 006-088-H03, 006-102-H05, AK061826, J013105M07, J013155A16, J033025C03, J033072L20, J033095I15, J033105E03, J033112G18, J033125D09, J065100L16, J065176I05, J090001C14, J090058E15, J090068F07
REGAGTTGGGCCGAA+1465583914655850006-031-B11, 006-083-B11, 006-083-C09, 006-088-H03, 006-102-H05, AK061826, J013105M07, J013155A16, J033025C03, J033072L20, J033095I15, J033105E03, J033112G18, J033125D09, J065100L16, J065176I05, J090001C14, J090058E15, J090068F07
REGCCCAGCCCATTT+1465586314655874006-031-B11, 006-083-B11, 006-083-C09, 006-088-H03, 006-102-H05, AK061826, J013105M07, J013155A16, J033025C03, J033072L20, J033095I15, J033105E03, J033112G18, J033125D09, J065100L16, J065176I05, J090001C14, J090058E15, J090068F07
REGAAAAGCCCAAACCGGCCCACCAC+1465589514655917006-031-B11, 006-083-B11, 006-083-C09, 006-088-H03, 006-102-H05, AK061826, J013105M07, J013155A16, J033025C03, J033072L20, J033095I15, J033105E03, J033112G18, J033125D09, J065100L16, J065176I05, J090001C14, J090058E15, J090068F07
 OsREG419AAAAGCCC                PPDB MotifGCCCA  PLACE Motif 
 OsREG421 AAAGCCCA               PPDB MotifGCCCA  PLACE Motif 
 OsREG426  AAGCCCAA              PPDB MotifGCCCA  PLACE Motif 
 OsREG457   AGCCCAAA             PPDB MotifGCCCA  PLACE Motif 
 OsREG593    GCCCAAAC            PPDB MotifGCCCA  PLACE Motif 
 OsREG440          ACCGGCCC      PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
 OsREG542           CCGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG564            CGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628             GGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG599              GCCCACCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG527               CCCACCAC PPDB MotifGCCCA  PLACE Motif 

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.