version
PlantPromoterDB promoter information of AK060388

Summary of Gene (AK060388)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0358300        NCBI 
Gene model AK060388  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 14658117-14656918)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK060388                         5'->3' (-)
Promoter sequence

 
006-031-B11         
006-083-B11         
006-083-C09         
006-088-H03         
006-102-H05         
AK061826            
J013105M07          
J013155A16          
J033025C03          
J033072L20          
J033095I15          
J033105E03          
J033112G18          
J033125D09          
J065100L16          
J065176I05          
J090001C14          
J090058E15          
J090068F07          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK060388

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-14655792-25

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCCTC-1465582814655835-61-68
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTCGGCCCAACT-1465583914655850-72-83
 OsREG642TTCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG658 TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563  CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626   GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG479    GCCCAACT PPDB MotifGCCCA  PLACE Motif 
REGAAATGGGCTGGG-1465586314655874-96-107
 OsREG422AAATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG432 AATGGGCT    PPDB MotifGCCCA  PLACE Motif 
 OsREG491  ATGGGCTG   PPDB MotifGCCCA  PLACE Motif 
 OsREG523   TGGGCTGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG533    GGGCTGGG PPDB MotifGCCCA  PLACE Motif 
REGGTGGTGGGCCGGTTTGGGCTTTT-1465589514655917-128-150
 OsREG527GTGGTGGG                PPDB MotifGCCCA  PLACE Motif 
 OsREG599 TGGTGGGC               PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGTGGGCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG564   GTGGGCCG             PPDB MotifGCCCA  PLACE Motif 
 OsREG542    TGGGCCGG            PPDB MotifGCCCA  PLACE Motif 
 OsREG440     GGGCCGGT           PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
 OsREG593           GTTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG457            TTTGGGCT    PPDB MotifGCCCA  PLACE Motif 
 OsREG426             TTGGGCTT   PPDB MotifGCCCA  PLACE Motif 
 OsREG421              TGGGCTTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG419               GGGCTTTT PPDB MotifGCCCA  PLACE Motif 
REGGCCGTCCG-1465602714656034-260-267
 OsREG562GCCGTCCG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.