version
PlantPromoterDB promoter information of AK060496

Summary of Gene (AK060496)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0851000        NCBI 
Gene model AK060496  
Description Similar to Transcription factor homolog BTF3-like protein.  
#
#

Overview

Focused view (chromosome 3: 36672189-36673388)

Genome position     
from initiation codon
006-098-C01         
009-061-A01         
AK062526            
AK102202            
AK104157            
J033087F19          
J065087I16          
J065113G04          
J090026M02          
J090027I04          
J100071B04          
J100071F04          
J100073E19          
TSS from cDNA
TSS information
AK060496                         5'->3' (+)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK060496

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+36672844-345

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCTCTT+3667287436672881-315-308
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACCGGGCC+3667273336672740-456-449
 OsREG441ACCGGGCC PPDB Motif  PLACE Motif 
REGTTGTGGGCCGGGCCCAAAC+3667277236672790-417-399
 OsREG597TTGTGGGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG627 TGTGGGCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG564  GTGGGCCG          PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG         PPDB MotifGCCCA  PLACE Motif 
 OsREG538    GGGCCGGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG614     GGCCGGGC       PPDB Motif  PLACE Motif 
 OsREG616      GCCGGGCC      PPDB Motif  PLACE Motif 
 OsREG543       CCGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG566        CGGGCCCA    PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG639         GGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625          GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG593           GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGTTTGGGCCGGC+3667279236672802-397-387
 OsREG625TTTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG563 TTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542  TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG615   GGGCCGGC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.