version
PlantPromoterDB promoter information of AK060996

Summary of Gene (AK060996)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0298900        NCBI 
Gene model AK060996  
Description Hypothetical protein.  
#
#

Overview

Focused view (chromosome 3: 10536557-10535358)

Genome position     
from initiation codon
006-028-C11         
TSS from cDNA
TSS information
AK060996                         5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK060996

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-10535793-236

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCTCCCTCT-1053580210535813-245-256
Y PatchTCCTCCCTTCTCC-1053582010535832-263-275
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGTGGGACCCAC-1053584610535857-289-300
 OsREG651GGTGGGAC     PPDB MotifGGGACCC  PLACE Motif 
 OsREG650 GTGGGACC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG648  TGGGACCC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG637   GGGACCCA  PPDB MotifGGGACCC  PLACE Motif 
 OsREG622    GGACCCAC PPDB MotifGGGACCC  PLACE Motif 
REGCCCGTGGGACCCAC-1053586410535877-307-320
 OsREG531CCCGTGGG       PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG650   GTGGGACC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG648    TGGGACCC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG637     GGGACCCA  PPDB MotifGGGACCC  PLACE Motif 
 OsREG622      GGACCCAC PPDB MotifGGGACCC  PLACE Motif 
REGGACGTGGC-1053590310535910-346-353
 OsREG585GACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.